ABM Reagents

<h2 dir="ltr"> What Are AAV CRISPR/Cas9 Negative Controls?</h2>
 AAV-delivered CRISPR/Cas9 is the dominant platform for in vivo gene editing in pre-clinical research. Matched negative controls are mandatory for valid interpretation of in vivo editing experiments because AAV transduction, Cas9 expression, and sgRNA processing each independently affect transduced cells regardless of target specificity. The right CRISPR/Cas9 control is essential for distinguishing editing effects from delivery and background responses. Select a control system appropriate for your genome editing workflow.
&nbsp;
<h2 dir="ltr">What you will find:</h2>
&nbsp;
<ul>
<li dir="ltr" role="presentation">SpCas9&nbsp; sgRNA AAV viruses control (serotypes 1&ndash;11) for Streptococcus pyogenes Cas9 experiments.</li>
<li dir="ltr" role="presentation">SaCas9 Scrambled sgRNA viruses control for the smaller Staphylococcus aureus Cas9 nuclease.</li>
<li dir="ltr" role="presentation">All-in-One AAV Control Vectors contain both a non-targeting scrambled sgRNA and saCas9&nbsp;&nbsp;</li>
<li dir="ltr" role="presentation">Non-Viral CRISPR Control Plasmids used in transient transfection studies for scrambled sgRNA expression&nbsp;</li>
<li dir="ltr" role="presentation">Ampicillin-Resistant AAV Backbones for stable cloning and propagation.&nbsp;</li>
<li dir="ltr" role="presentation">Serotype-Specific All-in-One Virions as a negative control for tissue-specific assessment</li>
</ul>
<h2 dir="ltr"> How to Choose an AAV CRISPR/Cas9 Control</h2>
 Cas9 Orthologue Matching Controls should match the Cas9 orthologue used experimentally &mdash; SpCas9 or the more compact SaCas9 (relevant for single-AAV delivery within the ~4.7 kb packaging limit). Non-Targeting sgRNA Validation As with other CRISPR delivery formats, non-targeting (not scrambled) sgRNAs bioinformatically verified against PAM-adjacent genomic sites are required to avoid unintended editing in the control group. Cas9-Inclusive vs. sgRNA-Only Format A non-targeting sgRNA + Cas9 AAV construct controls for the full system; an sgRNA-only (no Cas9) AAV construct isolates the contribution of guide RNA delivery alone. Serotype Matching for In Vivo Work The control AAV should match the serotype of the experimental construct to ensure equivalent tissue tropism and transduction efficiency in vivo. Split-Vector System Considerations For split-vector AAV-CRISPR systems (Cas9 and sgRNA on separate AAV particles), the control should replicate the same two-vector delivery approach. 
<h2 dir="ltr"> Specifications Context</h2>
&nbsp;
AAV delivery can activate innate immune pathways, while Cas9 expression may induce cellular stress and DNA damage responses. sgRNA is expressed in all transduced cells regardless of targeting sequence, making matched controls essential to distinguish on-target editing effects from vector- and CRISPR-related background activity. SaCas9 (~3.2 kb) is smaller than SpCas9 (~4.2 kb) and is often used for single-AAV delivery; controls should match the Cas9 orthologue used. Non-targeting sgRNA AAV controls &mdash; with and without Cas9 &mdash; are available from ABM (Applied Biological Materials) for both SpCas9 and SaCas9 systems. As with other AAV systems, matched production batches help reduce titer-related variability, and serotype-dependent transduction should be confirmed before in vivo studies due to differences in tissue tropism.
&nbsp;
<a href="https://mbpinc.net/contact-us" style="color: #236fa1;">Contact the expert team </a>at MBP to get high-quality CRISPR control for your next successful experiment.

CRISPR/Cas9 Control

AAV Packaging Protocol

Lentiviral Vector Amplification Protocol

AAV Infection Guideline

Selection-Drug Killing Curve

Lentivector Packaging Protocol

Lentivirus Infection Protocol

CRISPR Scrambled sgRNA All-in-One AAV Virus Amp (with saCas9) (Serotype 7)

K077a by Applied Biological Materials is an all-in-one saCas9 + scrambled sgRNA (5′-GCACTCACATCGCTACATCA-3′) AAV serotype 7 negative control virus. Supplied at 1011 GC/mL as 5 × 100 µL. Matched control for all-in-one saCas9/AAV7 CRISPR experiments. Store at −80°C; shipped on dry ice.

Unit Quantity

Vector map

Titer

Caution

Shipping Condition

CRISPR Scrambled sgRNA All-in-One AAV Virus Amp (with saCas9) (Serotype 8)

K078a by Applied Biological Materials is an all-in-one saCas9 + scrambled sgRNA (5′-GCACTCACATCGCTACATCA-3′) AAV serotype 8 negative control virus. Supplied at 1011 GC/mL as 5 × 100 µL. Ideal for liver and skeletal muscle saCas9 CRISPR studies. Store at −80°C; shipped on dry ice.

CRISPR Scrambled sgRNA All-in-One AAV Virus Amp (with saCas9) (Serotype 9)

K079a by Applied Biological Materials is an all-in-one CRISPR control AAV serotype 9 virus co-packaging saCas9 and a scrambled sgRNA (5′-GCACTCACATCGCTACATCA-3′). Supplied at 1011 GC/mL as 5 × 100 µL. Non-targeting negative control for saCas9/AAV9 CRISPR experiments. Store at −80°C; shipped on dry ice.

<h2 dir="ltr">What Are CRISPR/Cas9 Lentiviral Negative Controls?</h2>
 Because Cas9 protein, guide RNA, and viral vector introduction can each independently affect cell physiology, matched negative controls accounting for all these variables are necessary to confidently attribute phenotypic changes to specific on-target editing. Cas9 expression has been shown to induce cellular stress and DNA damage responses in some cell types, and guide RNA delivery can activate innate immune sensing in others. Well-designed controls are critical for genome-editing experiments. Select the CRISPR/Cas9 control system that supports reliable interpretation of results.
&nbsp;
<h2 dir="ltr">What you will find:</h2>
&nbsp;
<ul>
<li dir="ltr" style="font-family: arial, helvetica, sans-serif;" aria-level="1">
Scrambled sgRNA Lentiviruses as negative controls carrying non-targeting guide RNA&nbsp;
</li>
<li dir="ltr" style="font-family: arial, helvetica, sans-serif;" aria-level="1">
All-in-One Lentiviral Control Vectors for streamlined delivery using both spCas9 and a scrambled sgRNA&nbsp;
</li>
<li dir="ltr" style="font-family: arial, helvetica, sans-serif;" aria-level="1">
Scrambled sgRNA CRISPR Lentiviral Vectors used for expression of non-targeting guides in CRISPR activation or interference.
</li>
<li dir="ltr" style="font-family: arial, helvetica, sans-serif;" aria-level="1">
Pre-packaged CRISPR Lentiviruses for rapid delivery of control sgRNA and spCas9 into target cells.
</li>
</ul>
<h2 dir="ltr"> How to Choose CRISPR/Cas9 Negative Controls</h2>
 Cas9 Inclusion A non-targeting sgRNA + Cas9 vector controls for all components of the CRISPR system and is the primary experimental negative control. A non-targeting sgRNA vector without Cas9 isolates the contribution of sgRNA expression alone. sgRNA Validation Standard A well-designed control expresses a non-targeting sgRNA bioinformatically verified to have at least three mismatches or gaps to all PAM-adjacent genomic sites in human, mouse, and rat &mdash; using the same vector backbone, promoter, and selection marker as experimental sgRNA vectors. Why Not Scrambled sgRNA Unlike siRNA controls, scrambled sgRNA sequences are not recommended for CRISPR experiments &mdash; randomly rearranged guide sequences are statistically likely to target one or more genomic sites and could produce unintended editing with phenotypic consequences. Safe-Harbor Cutting Controls sgRNAs targeting a known safe-harbor locus (AAVS1 or ROSA26, with no known coding function) produce confirmed Cas9 cutting without a phenotypic readout &mdash; verifying the CRISPR system is functional while controlling for DSB induction at a neutral locus. Delivery System Matching For all-in-one Cas9 + sgRNA lentiviral systems, use a matched all-in-one non-targeting control; for two-vector systems, the sgRNA control should use the identical backbone as experimental guides; for inducible (Tet-On) Cas9, non-targeting controls should pair with the same Tet-On Cas9 vector. 
<h2 dir="ltr"> Specifications Context</h2>
 Non-targeting sgRNA controls are included as standard negative controls in genome-wide CRISPR library screens, with multiple distinct sequences distributed across the library to provide an internal, statistically robust baseline for scoring essential gene dropout and positive selection hits. Non-targeting control constructs are available with GFP, RFP, or other fluorescent reporter tags for FACS-based selection or monitoring of transduced populations. Like all lentiviral work, CRISPR lentiviral controls require institutional biosafety committee (IBC) approval before use, particularly when Cas9 is co-delivered; BSL-2 containment is standard for third-generation lentiviral packaging systems.&nbsp; 
&nbsp;
<a href="https://mbpinc.net/contact-us">Contact the expert MBP today</a> to request a quote for high-quality CRISPR control for your lab.

CRISPR Scrambled sgRNA All-in-One Lentiviral Vector (with spCas9)

CRISPR Scrambled sgRNA All-in-One Lentiviral Vector (with spCas9) (K010) by Applied Biological Materials is a 1.0 µg lentiviral plasmid co-encoding spCas9 and a scrambled non-targeting sgRNA (GCACTCACATCGCTACATCA), for use as a plasmid-level control in all-in-one lentiviral CRISPR-Cas9 experiments or for custom packaging. Plasmid form of K011. Store at –20°C or below.

Vector Map

CRISPR Scrambled sgRNA All-in-One Lentivirus (with spCas9)

CRISPR Scrambled sgRNA All-in-One Lentivirus (with spCas9) (K011) by Applied Biological Materials is a 10⁸ IU/mL lentivirus co-expressing spCas9 and a scrambled non-targeting sgRNA (GCACTCACATCGCTACATCA), supplied as 3 × 250 µl for use as a matched negative control in all-in-one lentiviral CRISPR-Cas9 gene editing experiments. Shipped on dry ice; store at –80°C.

CRISPR Scrambled sgRNA All-in-One Non-Viral Vector (with spCas9)

K094 by Applied Biological Materials is a 1.0 µg all-in-one non-viral CRISPR control plasmid co-encoding spCas9 and a scrambled sgRNA (5′-GCACTCACATCGCTACATCA-3′). Matched negative control for all-in-one non-viral spCas9 CRISPR experiments using lipofection, electroporation, or nucleofection. Store at −20°C or below.

<h2 dir="ltr"> What Are Adenoviral CRISPR/Cas9 Negative Controls?</h2>
 Adenoviral delivery of CRISPR/Cas9 components combines the immune stimulation of adenoviral capsid delivery with the cellular stress of Cas9 expression &mdash; making matched negative controls even more critical than in lentiviral CRISPR work, where vector-related immune activation is comparatively lower. Genome-editing studies benefit from appropriate validation controls. Select a CRISPR/Cas9 control construct for your adenoviral workflow.
&nbsp;
<h2 dir="ltr">What you will find:</h2>
&nbsp;
<ul>
<li dir="ltr" style="font-family: arial, helvetica, sans-serif;" aria-level="1">
Scrambled sgRNA CRISPR Adenoviruses: for spCas9-driven gene editing studies. It includes high-titer control viruses carrying non-targeting RNA as a guide.&nbsp;
</li>
</ul>
<h2 dir="ltr"> How to Choose Adenoviral CRISPR/Cas9 Controls</h2>
 Component Matching A valid control should use the same adenoviral Cas9 expression construct as experimental groups and express a non-targeting sgRNA, isolating editing-specific phenotypes from adenoviral delivery and Cas9 expression effects. Non-Targeting sgRNA Validation As with lentiviral CRISPR controls, non-targeting sgRNAs should be bioinformatically verified to have minimal homology to any genomic PAM-adjacent target site, avoiding unintended cutting. Cas9-Inclusive vs. sgRNA-Only Controls A non-targeting sgRNA + Cas9 construct controls for the full CRISPR system; a non-targeting sgRNA without Cas9 isolates the contribution of sgRNA delivery alone &mdash; both formats are useful depending on the experimental question. Combined Immune Response Considerations Because adenoviral capsid delivery and Cas9 expression each independently activate cellular stress responses, the negative control must deliver identical components (minus the targeting guide) to separate editing-specific effects from these combined non-specific responses. Scrambled sgRNA Caution As with other CRISPR delivery formats, scrambled (rather than non-targeting) sgRNA sequences are not recommended, since randomly rearranged guides may inadvertently target unintended genomic sites. 
<h2 dir="ltr"> Specifications Context</h2>
 Adenoviral delivery of CRISPR/Cas9 is widely used in pre-clinical gene editing studies where high-efficiency delivery is required in both dividing and non-dividing cells, making appropriate controls essential for interpretation due to vector-associated and Cas9-induced cellular responses. Non-targeting (scrambled) sgRNA adenoviral controls, including formats with Cas9 where applicable, are available from established manufacturers, including ABM (Applied Biological Materials). All adenoviral CRISPR work requires institutional biosafety committee (IBC) approval prior to use, and approval timelines should be considered early in project planning, as review may take several weeks depending on institutional processes. Product availability reflects MBP&rsquo;s catalogue as of mid-2026. 
&nbsp;
<a href="https://mbpinc.net/contact-us">Contact the expert team </a>at MBP today and get advanced adenoviral CRISPR controls for your lab today.

CRISPR Scrambled sgRNA CRISPR Adenovirus (for spCas9)

CRISPR Scrambled sgRNA CRISPR Adenovirus (for spCas9) (K020) by Applied Biological Materials is a packaged adenovirus at 10⁶ pfu/mL in DMEM + 10% glycerol expressing a scrambled non-targeting sgRNA (GCACTCACATCGCTACATCA) for spCas9, supplied as 1.0 ml for use as a matched transient negative control in adenoviral CRISPR-Cas9 gene editing experiments. Store at –80°C.

Storage Condition

CRISPR Scrambled sgRNA CRISPR Lentiviral Vector (for spCas9)

CRISPR Scrambled sgRNA CRISPR Lentiviral Vector (for spCas9) (K018) by Applied Biological Materials is a 1.0 µg lentiviral plasmid encoding a scrambled non-targeting sgRNA (GCACTCACATCGCTACATCA) for spCas9, for use as a plasmid-level control in CRISPR-Cas9 lentiviral experiments or for custom packaging of a matched scrambled sgRNA lentivirus. Store at –20°C or below.

CRISPR Scrambled sgRNA Lentivirus (for spCas9)

CRISPR Scrambled sgRNA Lentivirus (for spCas9) (K019) by Applied Biological Materials is a 10⁸ IU/mL lentivirus expressing a scrambled, non-targeting sgRNA (GCACTCACATCGCTACATCA) for spCas9, supplied as 3 × 250 µl for use as a matched negative control in CRISPR-Cas9 lentiviral gene editing experiments. Shipped on dry ice; store at –80°C.

Titer 

CRISPR Scrambled sgRNA Non-Viral Vector (for spCas9)

K093 by Applied Biological Materials is a 1.0 µg non-viral plasmid CRISPR control vector encoding a scrambled sgRNA (5′-GCACTCACATCGCTACATCA-3′) for spCas9. Matched negative control for non-viral spCas9 CRISPR experiments using lipofection, electroporation, or nucleofection. Store at −20°C or below.

<h2 dir="ltr">What Are Lentiviral &amp; Vector Systems for CRISPR?</h2>
 Lentiviral vector (LV) systems deliver CRISPR/Cas9 components with the capacity to carry complex transgenes and sustain robust, long-term expression across dividing and non-dividing cell types. Unlike transient transfection, lentiviral transduction integrates the transgene into the host genome, making it the method of choice for generating stable Cas9-expressing cell lines and pooled sgRNA library screens. The right vector system influences gene delivery efficiency, expression control, and experimental success. Select the platform that best fits your research objectives.
&nbsp;
<h2 dir="ltr">What you will find:</h2>
&nbsp;
<ul>
<li dir="ltr" aria-level="1">
Epigenetic Modulator Lentivirus (TET1CD/DNMT3A): Tailored viral platforms created for precise DNA methylation or demethylation to investigate gene control and epigenetic changes at particular sites.
</li>
<li dir="ltr" aria-level="1">
CRISPRa &amp; CRISPRi Delivery Mechanisms (VPR/KRAB): Advanced dCas9 lentiviral vectors designed for strong transcriptional enhancement or repression while preserving the original DNA sequence.
</li>
<li dir="ltr" aria-level="1">
Cas9 Nuclease &amp; Nickase Lentiviruses: Immediately usable viral particles that ensure effective transport of double-strand break or single-strand nicking enzymes for lasting site-directed mutagenesis.
</li>
<li dir="ltr" aria-level="1">
Lentiviral Cloning &amp; Expression Vectors: Adaptable transfection-ready genetic frameworks equipped with C-terminal tags and enhanced promoters for the creation of tailored guide RNA and effector proteins.
</li>
<li dir="ltr" aria-level="1">
Non-Viral Cas9 Vector Options: High-quality plasmid-based systems intended for temporary expression in scenarios where viral incorporation is not needed.
</li>
<li dir="ltr" aria-level="1">
High-Titer Packaging Solutions: Viral preparations safe from endotoxins, enhanced for optimal transduction efficiency in delicate therapeutic candidate evaluation and disease modeling.
</li>
</ul>
<h2 dir="ltr"> How to Choose Lentiviral/Vector CRISPR Systems</h2>
 Packaging Generation Second- and third-generation packaging designs progressively remove viral accessory genes (nef, vif, vpr, vpu) for enhanced biosafety. Third-generation systems split packaging components across two plasmids and eliminate the Tat transactivator, producing replication-incompetent particles suitable for BSL-2 settings. CRISPR-Specific Format Cas9 lentiviral plasmids provide stable Cas9 integration; pre-linearised sgRNA lentiviral plasmids are ready for guide sequence insertion; dox-inducible (Tet-On) Cas9 systems allow temporally controlled editing. Paired Cas9 and sgRNA vectors generate inducible stable editing cell lines. Transient vs. Stable Needs For experiments requiring transient editing without permanent genomic modification, all-in-one or dual-plasmid Cas9/sgRNA transfection systems (lipid-based or electroporation) are appropriate. For stable, heritable expression, lentiviral integration is required. Cell Type Lentiviral vectors transduce both dividing and non-dividing cells, including post-mitotic neurons and macrophages &mdash; applications that gamma-retroviral vectors cannot support. Screening Scale Pooled sgRNA libraries transduced at low MOI enable genome-wide functional screens; stable lentiviral Cas9 cell lines, generated once and banked, provide a consistent starting point for multiple guide RNA screen iterations. 
<h2 dir="ltr"> Specifications Context</h2>
 Lentiviral and vector systems support pooled genome-wide CRISPR knockout screens, stable Cas9 cell line generation, inducible gene editing models, hard-to-transfect primary cell engineering, and CAR-T cell development workflows. Lentiviral plasmids contain LTRs prone to recombination in standard E. coli strains &mdash; recombination-resistant strains such as Stbl3 are recommended for plasmid propagation. Integrase-deficient lentiviral vectors (IDLVs) or RNP electroporation are preferred where insertional mutagenesis risk must be minimised, such as therapeutic cell engineering. For research-scale work where stable integration is the goal, third-generation lentiviral systems remain the standard choice given their established safety record and broad cell-type compatibility across academic and industry labs. Labs new to lentiviral work often start with a well-characterised packaging system and a small pilot transduction before scaling to a full screen or stable line generation campaign.
&nbsp;
Reach out to the professional <a href="https://mbpinc.net/contact-us" style="color: #236fa1;">team at MBP Inc.</a> now to obtain a quote for the perfect Lentivirus system tailored to your research needs.

Vector & Lentivirus Systems

Lentivirus Systems

CRISPRa dCas9-VPR Lentiviral Vector

K097 by Applied Biological Materials is the CRISPRa dCas9-VPR Lentiviral Vector (10 µg) — a plasmid expressing dCas9 (D10A + H840A) fused to the VPR activator complex (VP64, p65, Rta) for sgRNA-directed endogenous gene activation. No MS2-modified sgRNAs required. Package with LV003 or LV053; pre-packaged lentivirus equivalent: K098 (108 IU/ml). Separate sgRNA (5'-NGG PAM; &minus;400 to +100 bp of TSS) needed. Store at &minus;20°C.

Vector

CRISPRa dCas9-VPR Lentivirus

K098 by Applied Biological Materials is the CRISPRa dCas9-VPR Lentivirus (3 × 250 µl at 108 IU/ml, Dry Ice) — pre-packaged, ready-to-use lentivirus expressing dCas9 (D10A + H840A) fused to the VPR activator complex (VP64, p65, Rta) for robust, sgRNA-directed transcriptional activation of endogenous genes. No MS2-modified sgRNAs required. Separate sgRNA (5'-NGG PAM; −400 to +100 bp of TSS) needed. Store at &minus;80°C.