Name: CRISPR Scrambled sgRNA CRISPR Lentiviral Vector (for spCas9)
SKU: K018
Price: 124.99 USD
Availability: InStock

<h2 dir="ltr">What Are CRISPR/Cas9 Lentiviral Negative Controls?</h2>
 Because Cas9 protein, guide RNA, and viral vector introduction can each independently affect cell physiology, matched negative controls accounting for all these variables are necessary to confidently attribute phenotypic changes to specific on-target editing. Cas9 expression has been shown to induce cellular stress and DNA damage responses in some cell types, and guide RNA delivery can activate innate immune sensing in others. Well-designed controls are critical for genome-editing experiments. Select the CRISPR/Cas9 control system that supports reliable interpretation of results.
&nbsp;
<h2 dir="ltr">What you will find:</h2>
&nbsp;
<ul>
<li dir="ltr" style="font-family: arial, helvetica, sans-serif;" aria-level="1">
Scrambled sgRNA Lentiviruses as negative controls carrying non-targeting guide RNA&nbsp;
</li>
<li dir="ltr" style="font-family: arial, helvetica, sans-serif;" aria-level="1">
All-in-One Lentiviral Control Vectors for streamlined delivery using both spCas9 and a scrambled sgRNA&nbsp;
</li>
<li dir="ltr" style="font-family: arial, helvetica, sans-serif;" aria-level="1">
Scrambled sgRNA CRISPR Lentiviral Vectors used for expression of non-targeting guides in CRISPR activation or interference.
</li>
<li dir="ltr" style="font-family: arial, helvetica, sans-serif;" aria-level="1">
Pre-packaged CRISPR Lentiviruses for rapid delivery of control sgRNA and spCas9 into target cells.
</li>
</ul>
<h2 dir="ltr"> How to Choose CRISPR/Cas9 Negative Controls</h2>
 Cas9 Inclusion A non-targeting sgRNA + Cas9 vector controls for all components of the CRISPR system and is the primary experimental negative control. A non-targeting sgRNA vector without Cas9 isolates the contribution of sgRNA expression alone. sgRNA Validation Standard A well-designed control expresses a non-targeting sgRNA bioinformatically verified to have at least three mismatches or gaps to all PAM-adjacent genomic sites in human, mouse, and rat &mdash; using the same vector backbone, promoter, and selection marker as experimental sgRNA vectors. Why Not Scrambled sgRNA Unlike siRNA controls, scrambled sgRNA sequences are not recommended for CRISPR experiments &mdash; randomly rearranged guide sequences are statistically likely to target one or more genomic sites and could produce unintended editing with phenotypic consequences. Safe-Harbor Cutting Controls sgRNAs targeting a known safe-harbor locus (AAVS1 or ROSA26, with no known coding function) produce confirmed Cas9 cutting without a phenotypic readout &mdash; verifying the CRISPR system is functional while controlling for DSB induction at a neutral locus. Delivery System Matching For all-in-one Cas9 + sgRNA lentiviral systems, use a matched all-in-one non-targeting control; for two-vector systems, the sgRNA control should use the identical backbone as experimental guides; for inducible (Tet-On) Cas9, non-targeting controls should pair with the same Tet-On Cas9 vector. 
<h2 dir="ltr"> Specifications Context</h2>
 Non-targeting sgRNA controls are included as standard negative controls in genome-wide CRISPR library screens, with multiple distinct sequences distributed across the library to provide an internal, statistically robust baseline for scoring essential gene dropout and positive selection hits. Non-targeting control constructs are available with GFP, RFP, or other fluorescent reporter tags for FACS-based selection or monitoring of transduced populations. Like all lentiviral work, CRISPR lentiviral controls require institutional biosafety committee (IBC) approval before use, particularly when Cas9 is co-delivered; BSL-2 containment is standard for third-generation lentiviral packaging systems.&nbsp; 
&nbsp;
<a href="https://mbpinc.net/contact-us">Contact the expert MBP today</a> to request a quote for high-quality CRISPR control for your lab.

CRISPR/Cas9 Control

AAV Infection Guideline

Selection-Drug Killing Curve

Lentivector Packaging Protocol

Lentiviral Vector Amplification Protocol

AAV Packaging Protocol

Lentivirus Infection Protocol

CRISPR Scrambled sgRNA CRISPR Lentiviral Vector (for spCas9)

CRISPR Scrambled sgRNA CRISPR Lentiviral Vector (for spCas9) (K018) by Applied Biological Materials is a 1.0 µg lentiviral plasmid encoding a scrambled non-targeting sgRNA (GCACTCACATCGCTACATCA) for spCas9, for use as a plasmid-level control in CRISPR-Cas9 lentiviral experiments or for custom packaging of a matched scrambled sgRNA lentivirus. Store at –20°C or below.