ABM Reagents

<h2 dir="ltr"> What Are AAV CRISPR/Cas9 Negative Controls?</h2>
 AAV-delivered CRISPR/Cas9 is the dominant platform for in vivo gene editing in pre-clinical research. Matched negative controls are mandatory for valid interpretation of in vivo editing experiments because AAV transduction, Cas9 expression, and sgRNA processing each independently affect transduced cells regardless of target specificity. The right CRISPR/Cas9 control is essential for distinguishing editing effects from delivery and background responses. Select a control system appropriate for your genome editing workflow.
&nbsp;
<h2 dir="ltr">What you will find:</h2>
&nbsp;
<ul>
<li dir="ltr" role="presentation">SpCas9&nbsp; sgRNA AAV viruses control (serotypes 1&ndash;11) for Streptococcus pyogenes Cas9 experiments.</li>
<li dir="ltr" role="presentation">SaCas9 Scrambled sgRNA viruses control for the smaller Staphylococcus aureus Cas9 nuclease.</li>
<li dir="ltr" role="presentation">All-in-One AAV Control Vectors contain both a non-targeting scrambled sgRNA and saCas9&nbsp;&nbsp;</li>
<li dir="ltr" role="presentation">Non-Viral CRISPR Control Plasmids used in transient transfection studies for scrambled sgRNA expression&nbsp;</li>
<li dir="ltr" role="presentation">Ampicillin-Resistant AAV Backbones for stable cloning and propagation.&nbsp;</li>
<li dir="ltr" role="presentation">Serotype-Specific All-in-One Virions as a negative control for tissue-specific assessment</li>
</ul>
<h2 dir="ltr"> How to Choose an AAV CRISPR/Cas9 Control</h2>
 Cas9 Orthologue Matching Controls should match the Cas9 orthologue used experimentally &mdash; SpCas9 or the more compact SaCas9 (relevant for single-AAV delivery within the ~4.7 kb packaging limit). Non-Targeting sgRNA Validation As with other CRISPR delivery formats, non-targeting (not scrambled) sgRNAs bioinformatically verified against PAM-adjacent genomic sites are required to avoid unintended editing in the control group. Cas9-Inclusive vs. sgRNA-Only Format A non-targeting sgRNA + Cas9 AAV construct controls for the full system; an sgRNA-only (no Cas9) AAV construct isolates the contribution of guide RNA delivery alone. Serotype Matching for In Vivo Work The control AAV should match the serotype of the experimental construct to ensure equivalent tissue tropism and transduction efficiency in vivo. Split-Vector System Considerations For split-vector AAV-CRISPR systems (Cas9 and sgRNA on separate AAV particles), the control should replicate the same two-vector delivery approach. 
<h2 dir="ltr"> Specifications Context</h2>
&nbsp;
AAV delivery can activate innate immune pathways, while Cas9 expression may induce cellular stress and DNA damage responses. sgRNA is expressed in all transduced cells regardless of targeting sequence, making matched controls essential to distinguish on-target editing effects from vector- and CRISPR-related background activity. SaCas9 (~3.2 kb) is smaller than SpCas9 (~4.2 kb) and is often used for single-AAV delivery; controls should match the Cas9 orthologue used. Non-targeting sgRNA AAV controls &mdash; with and without Cas9 &mdash; are available from ABM (Applied Biological Materials) for both SpCas9 and SaCas9 systems. As with other AAV systems, matched production batches help reduce titer-related variability, and serotype-dependent transduction should be confirmed before in vivo studies due to differences in tissue tropism.
&nbsp;
<a href="https://mbpinc.net/contact-us" style="color: #236fa1;">Contact the expert team </a>at MBP to get high-quality CRISPR control for your next successful experiment.

CRISPR/Cas9 Control

Lentiviral Vector Amplification Protocol

AAV Infection Guideline

AAV Packaging Protocol

Selection-Drug Killing Curve

Lentivector Packaging Protocol

Lentivirus Infection Protocol

CRISPR Scrambled sgRNA AAV Virus Amp (for spCas9) (Serotype 7)

CRISPR Scrambled sgRNA AAV Virus Amp (for spCas9)(Serotype 7) (K057a) by Applied Biological Materials is a packaged AAV7 CRISPR control virus at 10¹¹ GC/mL expressing a scrambled non-targeting sgRNA (GCACTCACATCGCTACATCA) for spCas9, supplied as 5 × 100 µl as a matched negative control in AAV7-delivered CRISPR-spCas9 editing experiments. Shipped on dry ice; store at –80°C.

Unit Quantity

Vector Map

Titer

Caution

Shipping Condition

CRISPR Scrambled sgRNA AAV Virus Amp (for spCas9) (Serotype 8)

K058a by Applied Biological Materials is a spCas9-compatible scrambled sgRNA AAV serotype 8 control virus. Supplied at 1011 GC/mL as 5 × 100 µL. Matched negative control for dual-vector spCas9/AAV8 CRISPR experiments. Requires separate spCas9. Store at −80°C; shipped on dry ice.

CRISPR Scrambled sgRNA AAV Virus Amp (for spCas9) (Serotype 9)

K059a by Applied Biological Materials is a CRISPR negative control AAV serotype 9 virus encoding a scrambled sgRNA (5′-GCACTCACATCGCTACATCA-3′) for spCas9. Supplied at 1011 GC/mL as 5 × 100 µL. sgRNA-only vector; requires separate spCas9. Store at −80°C; shipped on dry ice.

CRISPR Scrambled sgRNA All-in-One AAV vector (with saCas9)

K070a by Applied Biological Materials is a 1.0 µg all-in-one saCas9 + scrambled sgRNA (5′-GCACTCACATCGCTACATCA-3′) AAV plasmid control vector. Negative control for all-in-one saCas9 CRISPR transfection experiments or as plasmid for custom AAV packaging. Store at −20°C or below.

Vector map

CRISPR Scrambled sgRNA All-in-One AAV Virus Amp (with saCas9) (Serotype 1)

K071a by Applied Biological Materials is an all-in-one saCas9 + scrambled sgRNA AAV serotype 1 negative control virus. Supplied at 1011 GC/mL as 5 × 100 µL. Matched control for all-in-one saCas9/AAV1 CRISPR experiments, including skeletal muscle and neuron applications. Store at −80°C; shipped on dry ice.

CRISPR Scrambled sgRNA All-in-One AAV Virus amp (with saCas9) (Serotype 10)

K082a by Applied Biological Materials is an all-in-one saCas9 + scrambled sgRNA (5′-GCACTCACATCGCTACATCA-3′) AAV serotype 10 negative control virus. Supplied at 1011 GC/mL as 5 × 100 µL. Matched control for all-in-one saCas9/AAV10 CRISPR experiments. Store at −80°C; shipped on dry ice.

CRISPR Scrambled sgRNA All-in-One AAV Virus Amp (with saCas9) (Serotype 11)

K085a by Applied Biological Materials is an all-in-one saCas9 + scrambled sgRNA (5′-GCACTCACATCGCTACATCA-3′) AAV serotype 11 negative control virus. Supplied at 1011 GC/mL as 5 × 100 µL. Matched control for all-in-one saCas9/AAV11 CRISPR experiments. Store at −80°C; shipped on dry ice.

CRISPR Scrambled sgRNA All-in-One AAV Virus Amp (with saCas9) (Serotype 2)

K072a by Applied Biological Materials is an all-in-one saCas9 + scrambled sgRNA (5′-GCACTCACATCGCTACATCA-3′) AAV serotype 2 negative control virus. Supplied at 1011 GC/mL as 5 × 100 µL. Matched control for all-in-one saCas9/AAV2 CRISPR experiments. Store at −80°C; shipped on dry ice.

CRISPR Scrambled sgRNA All-in-One AAV Virus Amp (with saCas9) (Serotype 3)

K073a by Applied Biological Materials is an all-in-one saCas9 + scrambled sgRNA (5′-GCACTCACATCGCTACATCA-3′) AAV serotype 3 negative control virus. Supplied at 1011 GC/mL as 5 × 100 µL. Matched control for all-in-one saCas9/AAV3 CRISPR experiments. Store at −80°C; shipped on dry ice.

CRISPR Scrambled sgRNA All-in-One AAV Virus Amp (with saCas9) (Serotype 4)

K074a by Applied Biological Materials is an all-in-one saCas9 + scrambled sgRNA (5′-GCACTCACATCGCTACATCA-3′) AAV serotype 4 negative control virus. Supplied at 1011 GC/mL as 5 × 100 µL. Matched control for all-in-one saCas9/AAV4 CRISPR experiments. Store at −80°C; shipped on dry ice.

CRISPR Scrambled sgRNA All-in-One AAV Virus Amp (with saCas9) (Serotype 5)

K075a by Applied Biological Materials is an all-in-one CRISPR negative control AAV serotype 5 virus delivering saCas9 and a scrambled sgRNA (5′-GCACTCACATCGCTACATCA-3′). Supplied at 1011 GC/mL as 5 × 100 µL. Preferred serotype for retinal and CNS studies. Store at −80°C; shipped on dry ice.

CRISPR Scrambled sgRNA All-in-One AAV Virus Amp (with saCas9) (Serotype 6)

K076a by Applied Biological Materials is an all-in-one saCas9 + scrambled sgRNA (5′-GCACTCACATCGCTACATCA-3′) AAV serotype 6 negative control virus. Supplied at 1011 GC/mL as 5 × 100 µL. Matched control for all-in-one saCas9/AAV6 CRISPR experiments, including HSC and myoblast applications. Store at −80°C; shipped on dry ice.