Name: CRISPR Scrambled sgRNA AAV Vector Amp (for saCas9)
SKU: K060a
Price: 124.99 USD
Availability: InStock

<h2 dir="ltr"> What Are AAV CRISPR/Cas9 Negative Controls?</h2>
 AAV-delivered CRISPR/Cas9 is the dominant platform for in vivo gene editing in pre-clinical research. Matched negative controls are mandatory for valid interpretation of in vivo editing experiments because AAV transduction, Cas9 expression, and sgRNA processing each independently affect transduced cells regardless of target specificity. The right CRISPR/Cas9 control is essential for distinguishing editing effects from delivery and background responses. Select a control system appropriate for your genome editing workflow.
&nbsp;
<h2 dir="ltr">What you will find:</h2>
&nbsp;
<ul>
<li dir="ltr" role="presentation">SpCas9&nbsp; sgRNA AAV viruses control (serotypes 1&ndash;11) for Streptococcus pyogenes Cas9 experiments.</li>
<li dir="ltr" role="presentation">SaCas9 Scrambled sgRNA viruses control for the smaller Staphylococcus aureus Cas9 nuclease.</li>
<li dir="ltr" role="presentation">All-in-One AAV Control Vectors contain both a non-targeting scrambled sgRNA and saCas9&nbsp;&nbsp;</li>
<li dir="ltr" role="presentation">Non-Viral CRISPR Control Plasmids used in transient transfection studies for scrambled sgRNA expression&nbsp;</li>
<li dir="ltr" role="presentation">Ampicillin-Resistant AAV Backbones for stable cloning and propagation.&nbsp;</li>
<li dir="ltr" role="presentation">Serotype-Specific All-in-One Virions as a negative control for tissue-specific assessment</li>
</ul>
<h2 dir="ltr"> How to Choose an AAV CRISPR/Cas9 Control</h2>
 Cas9 Orthologue Matching Controls should match the Cas9 orthologue used experimentally &mdash; SpCas9 or the more compact SaCas9 (relevant for single-AAV delivery within the ~4.7 kb packaging limit). Non-Targeting sgRNA Validation As with other CRISPR delivery formats, non-targeting (not scrambled) sgRNAs bioinformatically verified against PAM-adjacent genomic sites are required to avoid unintended editing in the control group. Cas9-Inclusive vs. sgRNA-Only Format A non-targeting sgRNA + Cas9 AAV construct controls for the full system; an sgRNA-only (no Cas9) AAV construct isolates the contribution of guide RNA delivery alone. Serotype Matching for In Vivo Work The control AAV should match the serotype of the experimental construct to ensure equivalent tissue tropism and transduction efficiency in vivo. Split-Vector System Considerations For split-vector AAV-CRISPR systems (Cas9 and sgRNA on separate AAV particles), the control should replicate the same two-vector delivery approach. 
<h2 dir="ltr"> Specifications Context</h2>
&nbsp;
AAV delivery can activate innate immune pathways, while Cas9 expression may induce cellular stress and DNA damage responses. sgRNA is expressed in all transduced cells regardless of targeting sequence, making matched controls essential to distinguish on-target editing effects from vector- and CRISPR-related background activity. SaCas9 (~3.2 kb) is smaller than SpCas9 (~4.2 kb) and is often used for single-AAV delivery; controls should match the Cas9 orthologue used. Non-targeting sgRNA AAV controls &mdash; with and without Cas9 &mdash; are available from ABM (Applied Biological Materials) for both SpCas9 and SaCas9 systems. As with other AAV systems, matched production batches help reduce titer-related variability, and serotype-dependent transduction should be confirmed before in vivo studies due to differences in tissue tropism.
&nbsp;
<a href="https://mbpinc.net/contact-us" style="color: #236fa1;">Contact the expert team </a>at MBP to get high-quality CRISPR control for your next successful experiment.

CRISPR/Cas9 Control

Lentiviral Vector Amplification Protocol

AAV Packaging Protocol

Selection-Drug Killing Curve

Lentivector Packaging Protocol

AAV Infection Guideline

Lentivirus Infection Protocol

CRISPR Scrambled sgRNA AAV Vector Amp (for saCas9)

CRISPR Scrambled sgRNA AAV Vector Amp (for saCas9) (K060a) by Applied Biological Materials is a 1.0 µg AAV plasmid encoding a scrambled non-targeting sgRNA (GCACTCACATCGCTACATCA) for saCas9 with Amp resistance, for use as a plasmid-level control in CRISPR-saCas9 AAV experiments or for custom in-house packaging of a matched saCas9 scrambled sgRNA AAV virus. Store at –20°C or below.